Por favor, use este identificador para citar o enlazar este ítem:
http://dspace.udla.edu.ec/handle/33000/12506| Tipo de material : | bachelorThesis |
| Título : | Detección de la presencia del hongo Batrachochytrium dendrobatidis y Batrachochytrium salmandrivorans mediante PCR en tiempo real en muestras de tejidos de anfibios de centros de conservación de Quito |
| Autor : | Alvarado Casamín, Solange Ariadne |
| Tutor : | Brunelle Muslin, Claire Christine |
| Palabras clave : | MEDICINA VETERINARIA;ENFERMEDADES INFECCIOSAS;QUITRIDIOMICOSIS;ANFIBIOS |
| Fecha de publicación : | 2020 |
| Editorial : | Quito: Universidad de las Américas, 2020 |
| Citación : | Alvarado, S. (2020). Detección de la presencia del hongo Batrachochytrium dendrobatidis y Batrachochytrium salmandrivorans mediante PCR en tiempo real en muestras de tejidos de anfibios de centros de conservación de Quito (Tesis de pregrado). Universidad de las Américas, Quito. |
| Resumen : | Actualmente, los anfibios han experimentado pérdidas de población en todo el mundo por enfermedades infecciosas como la quitridiomicosis... |
| Descripción : | Currently, amphibians have experienced population losses worldwide from infectious diseases such as chytridiomycosis. The following study focused on finding the presence of Batrachochytrium dendrobatidis (Bd) and Batrachochytrium salamandrivorans (Bsal) in captive and field amphibians. Sampling was carried out using skin swabs in live animals and in dead animals, different tissues were extracted such as: skin, oral cavity, limb tissue. DNA extraction was performed and the design and standardization of two real-time PCR assays were made for each fungus using: primers for Bd forward CCTTGATATAATACAGTGTGCCATA-TGTC, reverse GCATTTCGCTGCGTTCTTCA, and probe [FAM] TTGACAACG-GATCTCTTGGCTCalGCAA and for BsTCalGCAA forward ATCTCCCCCTCTT-CATCCCTAA, reverse CATCGAATCTTTGAACGCACATTG and probe [HEX] CTA-TTGATTCTCAAACAGGCATACTCTACA. A denaturation protocol was used at 95 degrees Celsius for 2 minutes, alignment and extension at 63 degrees Celsius for 15 seconds for a total of 45 cycles. 126 samples from 47 animals were processed, resulting in 14 animals positive for Bd and 9 positive for Bsal, the most affected species being Gastrotheca riobambae and Gastrotheca orophylax, which confirms the presence of the infection in native species and in an exotic species Ambystoma. mexicanum. The results indicate a high frequency of 30 percent of Bd infection in the amphibian conservation centers of Quito. By obtaining positive results for Bsal with 19 percent frequency, it can be confirmed as one of the first findings of the infection in South America, which indicates the importance of control in the wild species trade and reaffirms the need to continue with the investigation of these pathogens in populations of different bioregions and conservation institutions of the country. |
| URI : | http://dspace.udla.edu.ec/handle/33000/12506 |
| Aparece en las colecciones: | Medicina Veterinaria y Zootecnia |
Ficheros en este ítem:
| Fichero | Descripción | Tamaño | Formato | |
|---|---|---|---|---|
| UDLA-EC-TMVZ-2020-46.pdf | 1,19 MB | Adobe PDF | Visualizar/Abrir |
Este ítem está sujeto a una licencia Creative Commons Licencia Creative Commons
